Is panspermia a scienctific theory?

[Sifmole]

[ QUOTE ]

[ QUOTE ]
But yet, isn't it absolutely fabulous that no scientist has ever been able to force the evolution of even single-celled organisms?

[/ QUOTE ]

I guess they do a pretty good job on dogs, cats, horses, cattle, etc., etc., etc.


[/ QUOTE ]

So are you comparing the selective breeding of animals guided by a knowledgable and INTENTIONAL individual with Evolution?

Let me be more clear: Has any scientist ever succeeded in taking a population of single-celled organisms, exposing them to some agent which causes mutations and created a population of something different than what they started with which retained these differences over at least two generations?

[ QUOTE ]
[ QUOTE ]
and there is absolutely no non-circumstantial evidence that any evolution has ever occured? Sure there are "this set of bones" and "that set of bones" that "look alot alike" so one must have evolved from the other or they must have evolved from a common ancestor

[/ QUOTE ]

What about all the gene stuff?


[/ QUOTE ]

What about it? This stuff looks alot like that stuff but is different in certain ways; So this stuff must have come from that stuff -- still not proof, conjecture.

[ QUOTE ]
[ QUOTE ]
I wrote in a post before, why does ET get a free-ride on that fact that it has proven untestable and is unverifiable? but ID is rightly ridiculed for that?

[/ QUOTE ]

Um, as said before, because it's falsifiable and actually has data supporting it, as opposed to just cute thinking.

[/ QUOTE ]

Please describe how ET would be falsified? How could one prove evolution doesn't or hasn't happened? I never stated that there is no data supporting ET; I asked where the verification is. A scientific theory needs to allow verification by providing predictive capability, and thus allows itself to be tested. How does ET do this?

[Rduke55]

[ QUOTE ]
So are you comparing the selective breeding of animals guided by a knowledgable and INTENTIONAL individual with Evolution?

[/ QUOTE ]

Well, I didn't understand what you're looking for. But I am comparing them. There's a lot of nice analogies there. Evolution is change in the genetic composition of a population during successive generations. This is due to selection acting on the genetic variation among individuals. (and can result in the development of new species - not in many of these examples of course).

[ QUOTE ]
Let me be more clear: Has any scientist ever succeeded in taking a population of single-celled organisms, exposing them to some agent which causes mutations and created a population of something different than what they started with which retained these differences over at least two generations?

[/ QUOTE ]

You do realize that speciation often takes a pretty long time don't you? So, no, in the few decades people have really been actively looking at this scientists have not been able to recreate the tens of thousands, hundred of thousands, or millions of years speciation normally takes.
And causing mutations is only one point of evolution, and that point is that they occur naturally so that's not really a hurdle. Most mutations are harmful.
But to get back to your single cell quesiton, how would you explain the development of bacteria resistant to antibiotics? Population of organisms exposed to a selection pressure and eventually you get a population very different form what they started with (not dying because of the antibiotics)


[ QUOTE ]
What about it? This stuff looks alot like that stuff but is different in certain ways; So this stuff must have come from that stuff -- still not proof, conjecture.

[/ QUOTE ]

A little more math though. How educated are you on this stuff that you can make those claims?

[ QUOTE ]
Please describe how ET would be falsified? How could one prove evolution doesn't or hasn't happened?

[/ QUOTE ]

Several of us have posted the "fossil rabbit in the precambrian" example.

[ QUOTE ]
A scientific theory needs to allow verification by providing predictive capability, and thus allows itself to be tested. How does ET do this?

[/ QUOTE ]

As one of the respected posters pointed out in another, similar thread, it doesn't neccessarily need to predict, it needs to explain.

[Sifmole]

[ QUOTE ]
[ QUOTE ]
So are you comparing the selective breeding of animals guided by a knowledgable and INTENTIONAL individual with Evolution?

[/ QUOTE ]

Well, I didn't understand what you're looking for. But I am comparing them. There's a lot of nice analogies there. Evolution is change in the genetic composition of a population during successive generations. This is due to selection acting on the genetic variation among individuals. (and can result in the development of new species - not in many of these examples of course).

[ QUOTE ]
Let me be more clear: Has any scientist ever succeeded in taking a population of single-celled organisms, exposing them to some agent which causes mutations and created a population of something different than what they started with which retained these differences over at least two generations?

[/ QUOTE ]

You do realize that speciation often takes a pretty long time don't you? So, no, in the few decades people have really been actively looking at this scientists have not been able to recreate the tens of thousands, hundred of thousands, or millions of years speciation normally takes.
And causing mutations is only one point of evolution, and that point is that they occur naturally so that's not really a hurdle. Most mutations are harmful.
But to get back to your single cell quesiton, how would you explain the development of bacteria resistant to antibiotics? Population of organisms exposed to a selection pressure and eventually you get a population very different form what they started with (not dying because of the antibiotics)


[ QUOTE ]
What about it? This stuff looks alot like that stuff but is different in certain ways; So this stuff must have come from that stuff -- still not proof, conjecture.

[/ QUOTE ]

A little more math though. How educated are you on this stuff that you can make those claims?

[ QUOTE ]
Please describe how ET would be falsified? How could one prove evolution doesn't or hasn't happened?

[/ QUOTE ]

Several of us have posted the "fossil rabbit in the precambrian" example.

[ QUOTE ]
A scientific theory needs to allow verification by providing predictive capability, and thus allows itself to be tested. How does ET do this?

[/ QUOTE ]

As one of the respected posters pointed out in another, similar thread, it doesn't neccessarily need to predict, it needs to explain.

[/ QUOTE ]

RE: Selective breeding vs Evolution

Doesn't drawing the similarity between selective breeding and ET seem a strange arguement to you? I'll explain why it seems strange to me: ET tells us that random ( or perhaps environmentally influenced ) mutations occured in various populations; some of these mutations resulted in a variation of the species that was better adapted to its living conditions and so this variation prospered over another. These mutations were carried forward, and over time more mutations, more prospering, etc until many varied types of animals occured.

However, the example you choose to put forward involves
1) concious effort on the part of the breeder to select mutations
2) results in minor ( in relation to the differences between an ameoba and a human ) differences that remain constrained by a ( and I am going to get the word wrong ) phylum or genus of a animal specie. No breeder has ever turned a Clydesdale into a Pug.

In your example you have the "I" from "ID", you have a designer -- the breeder.

Re: Speciation and Single-Cell organisms

I actually do realize that speciation ( although I did not know that was the applicable word ) takes a long long time. But my question wasn't "Has any scientist caused speciation in single-celled organisms?"; I was actually quite specific in my question, and the effect I was asking about was very limited. You did not respond to that question, it really should be a simple one: "Yes and here is a citation" or "No, actually no one has documented that yet."

Also, the statement that "well it takes hundred of thousands upon thousands of years" is one of the problems I have in ETs response to criticism. It really is not much different than "God works in mysterious ways". Neither response answers anything, and neither response furthers the ability to question and analyze.

Re: evolution, mutation, and well that ain't a hurdle

Mutations are only one point of evolution... um, kind of a starting point aren't they? If there were zero mutations could you have evolution? And yes most mutations are harmful ( I am actually curious what percentage of mutations are harmful ).

Mutations occur naturally so that is not much of a hurdle... Um, really the hurdle is explaining the process where by a mutated ameoba and its mutated progeny eventually become humans -- and I think that is a hurdle; why? because there is no test to show this happens, and I know of no experimentation that has resulted in even arguably simple evolutionary results. This is the thing I want to find in all this: has any scientist tried and what were the results.

Re: Bacteria and antibiotics

I don't know that the explanation requires evolution; I'd agree that a certain natural selection would be involved, but that does not require that a new strain of bacteria has been evolved only that a strain becomes more prevelant in that environment. Evolution would require that there were non-resistant strains which mutated and one of those mutations was resistance: such an environment should be reproducible and testable -- has it been?

Re: Stuff is like other Stuff

I have a basic understanding of genes, heredity, dominant, recessive, etc. Not hard-core DNA. But you still have not explained where the proof of relationship is. Does the information that specie A's DNA differs from specie B's by 2% neccessarily require that they at some point shared an ancestor specie C? There is an assumption built into ET that there was a single source ( or does the theory now include multiple sources ) of the orginal DNA and this over time modified in many branches to the species we have today. What if we chuck the original assumption just for the sake of questioning? Is there proof that leads us back there?

Re: fossil rabbit

I will have to search for this.

Re: It doesn't need to predict...

I don't know that I buy this, all respect to the poster you cite though. Another well respected writer, Karl Popper, and many others maintain that a good scientific theory needs to be 4 things: predictive, logical, testable, and never have been falsified. ID explains, but ID isn't science.

[tolbiny]

"Evolution would require that there were non-resistant strains which mutated and one of those mutations was resistance: such an environment should be reproducible and testable -- has it been?"

yeah, i did this in biology lab last semester. Its pretty simple really. You take a culture of bacteria and create a control environment- a plate of agar gel with antibiotics. A second plate with antibiotcs and a mutagenic substace. Using the same culture for both you will see colonies growing on the plate with the mutagenic substance.


"Has any scientist caused speciation in single-celled organisms?"
Speciation in single cell organisms is different from other organisms because they reproduce asexually, so you can't use traditional definitions of species on them- which is why "strains" are used and not species when describing bacteria and stuff.

"And yes most mutations are harmful" most mutations are not harmfull, most mutations are considered "neutral".

[Sifmole]

[ QUOTE ]
"Evolution would require that there were non-resistant strains which mutated and one of those mutations was resistance: such an environment should be reproducible and testable -- has it been?"

yeah, i did this in biology lab last semester. Its pretty simple really. You take a culture of bacteria and create a control environment- a plate of agar gel with antibiotics. A second plate with antibiotcs and a mutagenic substace. Using the same culture for both you will see colonies growing on the plate with the mutagenic substance.


"Has any scientist caused speciation in single-celled organisms?"
Speciation in single cell organisms is different from other organisms because they reproduce asexually, so you can't use traditional definitions of species on them- which is why "strains" are used and not species when describing bacteria and stuff.

"And yes most mutations are harmful" most mutations are not harmfull, most mutations are considered "neutral".

[/ QUOTE ]

Re: Experiment

So in no case did any student have colonies grow in the control plate? But colonies always grew on the mutagen plate? What was the mutagen? In what way did you confirm there were no resistant bacteria in either group prior to the introduction of/to the mutagen? Any chance you can provide a citation to any published article describing such an experiment?

Re: Speciation vs Strains

Great, thanks for the wording.

Re: Mutations, most neutral

Ok -- I was just going along with the other guys statement. I don't really know.

[hmkpoker]

[ QUOTE ]
So in no case did any student have colonies grow in the control plate? But colonies always grew on the mutagen plate? What was the mutagen? In what way did you confirm there were no resistant bacteria in either group prior to the introduction of/to the mutagen? Any chance you can provide a citation to any published article describing such an experiment?

[/ QUOTE ]

Do you honestly think he's going to go through all that trouble just to help reinforce his point to someone who's just going to disagree with it anyway? This is a 2+2 forum, not a serious academic exegesis.

[Sifmole]

[ QUOTE ]
[ QUOTE ]
So in no case did any student have colonies grow in the control plate? But colonies always grew on the mutagen plate? What was the mutagen? In what way did you confirm there were no resistant bacteria in either group prior to the introduction of/to the mutagen? Any chance you can provide a citation to any published article describing such an experiment?

[/ QUOTE ]

Do you honestly think he's going to go through all that trouble just to help reinforce his point to someone who's just going to disagree with it anyway? This is a 2+2 forum, not a serious academic exegesis.

[/ QUOTE ]

Actually the only hard part would be an honest attempt at a citation. The mutagen, the answer could well be, "I don't remember" and I would believe him just fine.

Let me state a couple of items clearly so we can continue:
1) I don't hold to ID, I don't believe it, it isn't science.

2) I believe that a good scientific theory has to allow itself to be tested and predict. ( lookup Karl Popper, if you are interested in some philosophy ( if you aren't already familiar ) ).

3) I have always wondered why scientists have not provided stronger proofs and experiements to support ET. Or if they have, why I have never heard of them. This is my complete and honest question.

[tolbiny]

"So in no case did any student have colonies grow in the control plate? But colonies always grew on the mutagen plate? What was the mutagen? In what way did you confirm there were no resistant bacteria in either group prior to the introduction of/to the mutagen?"

These experiments are just intro level biology labs designed to demonstrate mutagenic properties. Going into these labs the assumption is made that there aren't any resistant bacteria int the original strain. This is supported (not proved, but supported) by the fact that very rarely does a colonie of bacteria grow on the control plate (it does happen x% of the time- this percentage is sttributed to contamination in some cases and the natural rate of mutation in others). the ratio/size of colonies present on test to control plate is very high. You often get several dozen colonies growing on the test plates where as it is very rare to see even one on the control plate.
I don't know of any citations i could give you, its an experiment i've done several times (highs school, biology camp, college), and is very ingrained and accepted within the biology community. The original experiments that are cited (iirc) in the lab write ups were performed in the 50's or 60's, and so are quite old.

"Re: Mutations, most neutral"

There are a couple of types of mutations (i'm gonna grab my old bio book to make sure i get these right)

point mutations: As i am sure you know DNA is made up of base pairs - ACGT which line up with thier opposites TCGA to make a double sided chain- so that an example you could have a chain that looks like
AAGCTTAGCCGT
TTCGAATCGGCA
When copied a mistake might be made and the new chain could look like
AAGCTTACGGCT
TTCGAATGGGCA
These are the most common and usually are neither damaging or beneficial. These build up within populations over generations and provide a lot of variety and are a strength to the Punctuated Equilibrium crowd (if your not familier with PE let me know and i'll include a brief description in my next post).

Inversion where a section of DNA will be "flipped"
original
AACGTATGCATTAC
TTGCATACGTAATG
after
AACGTTACGTATAC
TTGCAATGCATATG

These are less common and more likely to be fatal

Insertion
Where a new stretch of DNA is inserted into the old string- usually from another portion of the DNA that gets cut out and "repasted" in the wrong place.
AACGTATGCATTAC
TTGCATACGTAATG
insertion
AACGTATACTTGATGCATTAC
TTGCATATGAACTACGTAATG

I believe these are the least common.

[Rduke55]

[Quote] However, the example you choose to put forward involves 1) concious effort on the part of the breeder to select mutations

[/ QUOTE ]

But the mutations' occurence are still random. Even in a relatively small genetic population like dogs (I'm talking originally - at the beginning of selective breeding) you can get wildly different organisms (for example, greyhound vs. bulldog) resulting from selection.

[ QUOTE ]
2) results in minor ( in relation to the differences between an ameoba and a human ) differences that remain constrained by a ( and I am going to get the word wrong ) phylum or genus of a animal specie.

[/ QUOTE ]

You're taking the extremes. Over the relatively short period breeders have created large differences between the wild animals and the result of breeding.

[ QUOTE ]
No breeder has ever turned a Clydesdale into a Pug.


[/ QUOTE ]

Neither has evolution. It doesn't work like that.

[ QUOTE ]
But my question wasn't "Has any scientist caused speciation in single-celled organisms?"; I was actually quite specific in my question, and the effect I was asking about was very limited. You did not respond to that question, it really should be a simple one: "Yes and here is a citation" or "No, actually no one has documented that yet."

[/ QUOTE ]

Resistance to antibiotics last for more than 2 generations. I'm not sure what you were asking then. You asked for an example, I gave one.

[ QUOTE ]
If there were zero mutations could you have evolution?

[/ QUOTE ]

No.

[ QUOTE ]
only that a strain becomes more prevelant in that environment.

[/ QUOTE ]

This is the whole point of natural selection.

[ QUOTE ]
Evolution would require that there were non-resistant strains which mutated and one of those mutations was resistance: such an environment should be reproducible and testable -- has it been?

[/ QUOTE ]

The point is that there was variation already in the population of bacteria. The selection pressure was the antibiotics.

[ QUOTE ]
Does the information that specie A's DNA differs from specie B's by 2% neccessarily require that they at some point shared an ancestor specie C?

[/ QUOTE ]

See a previous thread's Vitamin C explanation for an example.

[ QUOTE ]
ID explains, but ID isn't science.

[/ QUOTE ]

It's not falsifiable.

And after reading the other responses I should have said "Most mutations that affect phenotype are harmful" because most mutations are in the intron, etc. and are neutral.

P.S. Sorry for the curt replies. I have a ton of crap to do today. The funny thing is most of it involves a manuscript on evolution [img]/images/graemlins/tongue.gif[/img]

[tolbiny]

[ QUOTE ]
Let me be more clear: Has any scientist ever succeeded in taking a population of single-celled organisms, exposing them to some agent which causes mutations and created a population of something different than what they started with which retained these differences over at least two generations?

[/ QUOTE ]

I'm a buffoon some days- There is an excellent example of this- not in single cell organisms, but in Flax plants. This was thought to be a unique situation untill about a year ago where it was found in a second plant- i don't have links to this stuff, but i do have copies of some of these papers, i don't know if they are published on the web.

Here's the setup with flax- it has been used for centuries, its fibers are used to make linen and falx oil has been important in certain economies at different times. It was domesticated several thousand years ago (perhaps even 10k years ago).

Phenotype- the way an organism appears- ie you have blue eyes- we'll call that phenotype BE
Genotype- the genetic coding that results in a phenotype. you can have several different genotypes that result in the same phenotype- ie a gene with the code ACGTAACTAGT could code for blue eyes as could the code TTACTAGGCTAGC


A population of homogeneous flax plants are taken (that is all of the plants look the same and all of their offspring look the same, and all their offsprings' offspring look the same- so we are sure that there aren't recessive genes at work here). You take some of these original plants and stick them in a controlled environment and subject it to stresses (lack of water, lack of nutrients, temperature ranges outside its optimal habitat)- and then use these plants to reproduce. Their offspring are returned to normal conditions- regular sulight/temps ect- and a percentage of their offspring will exhibit a totally new phenotype. For example if all the original plants were Tall with Broad leaves (phenotype TB)- some of their offspring will now have the phenotype SB (short with broad leaves) or perhaps SN (short with narrow leaves). If you bread those with SN or SB- all of their offspring will be the same as the parent- that is SN will have offspring with phenotype SN, SB the same. They will not return to their parents phenotype no matter how many generations you grow them under optimal conditions.
When their genotypes are tested you find major differences between the parents of the original generation (TB) and thier phenotypically different offspring (SN). The amount of genetic material in the nucleus of a cell can be measured, and in this situation the parent (TB) and offsrping (SN) have different amounts of genetic material in their nucleus.