Is panspermia a scienctific theory?

[tolbiny]

"Evolution would require that there were non-resistant strains which mutated and one of those mutations was resistance: such an environment should be reproducible and testable -- has it been?"

yeah, i did this in biology lab last semester. Its pretty simple really. You take a culture of bacteria and create a control environment- a plate of agar gel with antibiotics. A second plate with antibiotcs and a mutagenic substace. Using the same culture for both you will see colonies growing on the plate with the mutagenic substance.


"Has any scientist caused speciation in single-celled organisms?"
Speciation in single cell organisms is different from other organisms because they reproduce asexually, so you can't use traditional definitions of species on them- which is why "strains" are used and not species when describing bacteria and stuff.

"And yes most mutations are harmful" most mutations are not harmfull, most mutations are considered "neutral".

[Sifmole]

[ QUOTE ]
"Evolution would require that there were non-resistant strains which mutated and one of those mutations was resistance: such an environment should be reproducible and testable -- has it been?"

yeah, i did this in biology lab last semester. Its pretty simple really. You take a culture of bacteria and create a control environment- a plate of agar gel with antibiotics. A second plate with antibiotcs and a mutagenic substace. Using the same culture for both you will see colonies growing on the plate with the mutagenic substance.


"Has any scientist caused speciation in single-celled organisms?"
Speciation in single cell organisms is different from other organisms because they reproduce asexually, so you can't use traditional definitions of species on them- which is why "strains" are used and not species when describing bacteria and stuff.

"And yes most mutations are harmful" most mutations are not harmfull, most mutations are considered "neutral".

[/ QUOTE ]

Re: Experiment

So in no case did any student have colonies grow in the control plate? But colonies always grew on the mutagen plate? What was the mutagen? In what way did you confirm there were no resistant bacteria in either group prior to the introduction of/to the mutagen? Any chance you can provide a citation to any published article describing such an experiment?

Re: Speciation vs Strains

Great, thanks for the wording.

Re: Mutations, most neutral

Ok -- I was just going along with the other guys statement. I don't really know.

[hmkpoker]

[ QUOTE ]
So in no case did any student have colonies grow in the control plate? But colonies always grew on the mutagen plate? What was the mutagen? In what way did you confirm there were no resistant bacteria in either group prior to the introduction of/to the mutagen? Any chance you can provide a citation to any published article describing such an experiment?

[/ QUOTE ]

Do you honestly think he's going to go through all that trouble just to help reinforce his point to someone who's just going to disagree with it anyway? This is a 2+2 forum, not a serious academic exegesis.

[Sifmole]

[ QUOTE ]
[ QUOTE ]
So in no case did any student have colonies grow in the control plate? But colonies always grew on the mutagen plate? What was the mutagen? In what way did you confirm there were no resistant bacteria in either group prior to the introduction of/to the mutagen? Any chance you can provide a citation to any published article describing such an experiment?

[/ QUOTE ]

Do you honestly think he's going to go through all that trouble just to help reinforce his point to someone who's just going to disagree with it anyway? This is a 2+2 forum, not a serious academic exegesis.

[/ QUOTE ]

Actually the only hard part would be an honest attempt at a citation. The mutagen, the answer could well be, "I don't remember" and I would believe him just fine.

Let me state a couple of items clearly so we can continue:
1) I don't hold to ID, I don't believe it, it isn't science.

2) I believe that a good scientific theory has to allow itself to be tested and predict. ( lookup Karl Popper, if you are interested in some philosophy ( if you aren't already familiar ) ).

3) I have always wondered why scientists have not provided stronger proofs and experiements to support ET. Or if they have, why I have never heard of them. This is my complete and honest question.

[Rduke55]

[Quote] However, the example you choose to put forward involves 1) concious effort on the part of the breeder to select mutations

[/ QUOTE ]

But the mutations' occurence are still random. Even in a relatively small genetic population like dogs (I'm talking originally - at the beginning of selective breeding) you can get wildly different organisms (for example, greyhound vs. bulldog) resulting from selection.

[ QUOTE ]
2) results in minor ( in relation to the differences between an ameoba and a human ) differences that remain constrained by a ( and I am going to get the word wrong ) phylum or genus of a animal specie.

[/ QUOTE ]

You're taking the extremes. Over the relatively short period breeders have created large differences between the wild animals and the result of breeding.

[ QUOTE ]
No breeder has ever turned a Clydesdale into a Pug.


[/ QUOTE ]

Neither has evolution. It doesn't work like that.

[ QUOTE ]
But my question wasn't "Has any scientist caused speciation in single-celled organisms?"; I was actually quite specific in my question, and the effect I was asking about was very limited. You did not respond to that question, it really should be a simple one: "Yes and here is a citation" or "No, actually no one has documented that yet."

[/ QUOTE ]

Resistance to antibiotics last for more than 2 generations. I'm not sure what you were asking then. You asked for an example, I gave one.

[ QUOTE ]
If there were zero mutations could you have evolution?

[/ QUOTE ]

No.

[ QUOTE ]
only that a strain becomes more prevelant in that environment.

[/ QUOTE ]

This is the whole point of natural selection.

[ QUOTE ]
Evolution would require that there were non-resistant strains which mutated and one of those mutations was resistance: such an environment should be reproducible and testable -- has it been?

[/ QUOTE ]

The point is that there was variation already in the population of bacteria. The selection pressure was the antibiotics.

[ QUOTE ]
Does the information that specie A's DNA differs from specie B's by 2% neccessarily require that they at some point shared an ancestor specie C?

[/ QUOTE ]

See a previous thread's Vitamin C explanation for an example.

[ QUOTE ]
ID explains, but ID isn't science.

[/ QUOTE ]

It's not falsifiable.

And after reading the other responses I should have said "Most mutations that affect phenotype are harmful" because most mutations are in the intron, etc. and are neutral.

P.S. Sorry for the curt replies. I have a ton of crap to do today. The funny thing is most of it involves a manuscript on evolution [img]/images/graemlins/tongue.gif[/img]

[tolbiny]

"So in no case did any student have colonies grow in the control plate? But colonies always grew on the mutagen plate? What was the mutagen? In what way did you confirm there were no resistant bacteria in either group prior to the introduction of/to the mutagen?"

These experiments are just intro level biology labs designed to demonstrate mutagenic properties. Going into these labs the assumption is made that there aren't any resistant bacteria int the original strain. This is supported (not proved, but supported) by the fact that very rarely does a colonie of bacteria grow on the control plate (it does happen x% of the time- this percentage is sttributed to contamination in some cases and the natural rate of mutation in others). the ratio/size of colonies present on test to control plate is very high. You often get several dozen colonies growing on the test plates where as it is very rare to see even one on the control plate.
I don't know of any citations i could give you, its an experiment i've done several times (highs school, biology camp, college), and is very ingrained and accepted within the biology community. The original experiments that are cited (iirc) in the lab write ups were performed in the 50's or 60's, and so are quite old.

"Re: Mutations, most neutral"

There are a couple of types of mutations (i'm gonna grab my old bio book to make sure i get these right)

point mutations: As i am sure you know DNA is made up of base pairs - ACGT which line up with thier opposites TCGA to make a double sided chain- so that an example you could have a chain that looks like
AAGCTTAGCCGT
TTCGAATCGGCA
When copied a mistake might be made and the new chain could look like
AAGCTTACGGCT
TTCGAATGGGCA
These are the most common and usually are neither damaging or beneficial. These build up within populations over generations and provide a lot of variety and are a strength to the Punctuated Equilibrium crowd (if your not familier with PE let me know and i'll include a brief description in my next post).

Inversion where a section of DNA will be "flipped"
original
AACGTATGCATTAC
TTGCATACGTAATG
after
AACGTTACGTATAC
TTGCAATGCATATG

These are less common and more likely to be fatal

Insertion
Where a new stretch of DNA is inserted into the old string- usually from another portion of the DNA that gets cut out and "repasted" in the wrong place.
AACGTATGCATTAC
TTGCATACGTAATG
insertion
AACGTATACTTGATGCATTAC
TTGCATATGAACTACGTAATG

I believe these are the least common.

[tolbiny]

[ QUOTE ]
Let me be more clear: Has any scientist ever succeeded in taking a population of single-celled organisms, exposing them to some agent which causes mutations and created a population of something different than what they started with which retained these differences over at least two generations?

[/ QUOTE ]

I'm a buffoon some days- There is an excellent example of this- not in single cell organisms, but in Flax plants. This was thought to be a unique situation untill about a year ago where it was found in a second plant- i don't have links to this stuff, but i do have copies of some of these papers, i don't know if they are published on the web.

Here's the setup with flax- it has been used for centuries, its fibers are used to make linen and falx oil has been important in certain economies at different times. It was domesticated several thousand years ago (perhaps even 10k years ago).

Phenotype- the way an organism appears- ie you have blue eyes- we'll call that phenotype BE
Genotype- the genetic coding that results in a phenotype. you can have several different genotypes that result in the same phenotype- ie a gene with the code ACGTAACTAGT could code for blue eyes as could the code TTACTAGGCTAGC


A population of homogeneous flax plants are taken (that is all of the plants look the same and all of their offspring look the same, and all their offsprings' offspring look the same- so we are sure that there aren't recessive genes at work here). You take some of these original plants and stick them in a controlled environment and subject it to stresses (lack of water, lack of nutrients, temperature ranges outside its optimal habitat)- and then use these plants to reproduce. Their offspring are returned to normal conditions- regular sulight/temps ect- and a percentage of their offspring will exhibit a totally new phenotype. For example if all the original plants were Tall with Broad leaves (phenotype TB)- some of their offspring will now have the phenotype SB (short with broad leaves) or perhaps SN (short with narrow leaves). If you bread those with SN or SB- all of their offspring will be the same as the parent- that is SN will have offspring with phenotype SN, SB the same. They will not return to their parents phenotype no matter how many generations you grow them under optimal conditions.
When their genotypes are tested you find major differences between the parents of the original generation (TB) and thier phenotypically different offspring (SN). The amount of genetic material in the nucleus of a cell can be measured, and in this situation the parent (TB) and offsrping (SN) have different amounts of genetic material in their nucleus.